version
PlantPromoterDB promoter information of AK071632

Summary of Gene (AK071632)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0586900        NCBI 
Gene model AK071632  
Description Similar to ADP-ribosylation factor-like protein 5.  
#
#

Overview

Focused view (chromosome 11: 24057550-24058749)

Genome position     
from initiation codon
AK058229            
J023049H24          
J023101B18          
J023104M08          
J065113K16          
J065129H17          
J065209I03          
J075027I19          
J075056M03          
J075119L16          
J075148G16          
TSS from cDNA
TSS information
AK071632                         5'->3' (+)
Promoter sequence












 
                    
Os11g0586875        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071632

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+24058419-131

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTT+2405838124058389-169-161
Y PatchTCTTCCTCCTCC+2405839224058403-158-147
Y PatchCTTCCTCCC+2405844324058451-107-99
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGCCCAAGCCCATGGAAGGCCCAGCCCAACT+2405823724058269-313-281
 OsREG435ACAGCCCA                          PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA              CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG                        PPDB MotifGCCCA  PLACE Motif 
 OsREG519     CCAAGCCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG496      CAAGCCCA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG429       AAGCCCAT                   PPDB MotifGCCCA  PLACE Motif 
 OsREG467        AGCCCATG                  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525         GCCCATGG                 PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG430                 AAGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG473                  AGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620                   GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603                    GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533                     CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523                      CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG458                        AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479                         GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.