version
PlantPromoterDB promoter information of AK071931

Summary of Gene (AK071931)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0411300        NCBI 
Gene model AK071931  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 5: 20124135-20122936)

Genome position     
from initiation codon
014-098-D05         
015-093-F04         
AK073142            
J033024D10          
J033123F23          
J043040A19          
J100017D21          
TSS from cDNA
TSS information
AK071931                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071931

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-20123912-777

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGTGGGCCCCACGTGTC-2012395320123970-818-835
 OsREG449ACGTGGGC           PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450       CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508        CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434         CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509          CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTTGTGGGCCCAGAT-2012397320123986-838-851
 OsREG597TTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629     GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486      GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGCCACCAACGGC-2012406920124079-934-944
 OsREG520CCACCAAC    PPDB MotifCCAACGG  PLACE Motif 
 OsREG518   CCAACGGC PPDB MotifCCAACGG  PLACE Motif 
REGCCGTGGGCCCG-2012416420124174-1029-1039
 OsREG547CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.