version
PlantPromoterDB promoter information of AK071955

Summary of Gene (AK071955)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0417200        NCBI 
Gene model AK071955  
Description Thioredoxin-like fold domain containing protein.  
#
#

Overview

Focused view (chromosome 5: 20444390-20445589)

Genome position     
from initiation codon
009-177-A02         
AK073199            
J033023K08          
TSS from cDNA
TSS information
AK071955                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071955

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+20445154-236

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCATAT+2044499420445002-396-388
 OsREG465AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480 GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCACAATGGGCCTTGCGGGCC+2044500720445034-383-356
 OsREG493ATTTGGGC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG431           AATGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG474            ATGGGCCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG430             TGGGCCTT        PPDB MotifGCCCA  PLACE Motif 
 OsREG497              GGGCCTTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG632                    TGCGGGCC PPDB Motif  PLACE Motif 
REGCTCGGCCCATGA+2044504520445056-345-334
 OsREG575CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609    GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCACGATGGGCCTT+2044506620445086-324-304
 OsREG610TAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG553          CGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590           GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474            ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430             TGGGCCTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.