version
PlantPromoterDB promoter information of AK072026

Summary of Gene (AK072026)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0648000        NCBI 
Gene model AK072026  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 27615747-27614548)

Genome position     
from initiation codon
003-131-D10         
AK066444            
J013066C13          
J013066C14          
J013072O16          
J065028G24          
J065052C07          
J065064I05          
J065078G15          
J065219P18          
TSS from cDNA
TSS information
AK072026                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072026

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-27615185-438

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGTGGGCCCAGCC-2761525127615265-504-518
 OsREG527GTGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579     GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG620      GGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603       GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTGGCCCACAGGTGGGTCCCAC-2761527727615303-530-556
 OsREG507GCCACGTGGC                  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG653     GTGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG654      TGGCCCAC              PPDB MotifGCCCA  PLACE Motif 
 OsREG627       GGCCCACA             PPDB MotifGCCCA  PLACE Motif 
 OsREG436            ACAGGTGG        PPDB Motif  PLACE Motif 
 OsREG514             CAGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG622                GTGGGTCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG637                 TGGGTCCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648                  GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650                   GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGGACCCACGTG-2761532027615330-573-583
 OsREG622GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG508   CCCACGTG PPDB MotifACGT  PLACE Motif 
REGGACACGTGG-2761534327615351-596-604
 OsREG509GACACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.