version
PlantPromoterDB promoter information of AK072089

Summary of Gene (AK072089)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0504400        NCBI 
Gene model AK072089  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 25023746-25022547)

Genome position     
from initiation codon
014-015-C10         
AK069190            
J023006O19          
J033041C11          
TSS from cDNA
TSS information
AK072089                         5'->3' (-)
Promoter sequence









 
009-010-E07         
AK062330            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072089

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-25022786-40

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCATGGGCCGAA-2502285125022862-105-116
 OsREG609TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGCGGGTGGGCCGAG-2502288025022892-134-146
 OsREG528CGGGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG600 GGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658    TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG575     GGGCCGAG PPDB MotifGCCCA  PLACE Motif 
REGCCAAGCCCATGGGCCCT-2502289825022914-152-168
 OsREG519CCAAGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT        PPDB MotifGCCCA  PLACE Motif 
 OsREG467   AGCCCATG       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525    GCCCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517       CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489        ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475         TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGGTGTCACT-2502293025022937-184-191
 OsREG477GTGTCACT PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+25023628AK062330, AK062330, 009-010-E07

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCCTC+2502366725023676009-010-E07, AK062330
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.