version
PlantPromoterDB promoter information of AK072535

Summary of Gene (AK072535)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0135900        NCBI 
Gene model AK072535  
Description Similar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment).  
#
#

Overview

Focused view (chromosome 8: 2027789-2028988)

Genome position     
from initiation codon
003-104-A01         
003-116-B04         
J013153P15          
J023133G14          
J033124B05          
J033130A14          
J090075C03          
J100029M15          
TSS from cDNA
TSS information
AK072535                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072535

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2028735-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATACCC+20287032028710-86-79
Y PatchTCTCCCCC+20287272028734-62-55
Y PatchTTCTCCTCCCT+20287452028755-44-34
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACACG+20285172028524-272-265
 OsREG573GCCACACG PPDB Motif  PLACE Motif 
REGGCCCCCAC+20285382028545-251-244
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGCCGATCCGGTGGGCCCGGT+20285532028571-236-218
 OsREG541CCGATCCG            PPDB Motif  PLACE Motif 
 OsREG628       GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640        GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566         TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543          GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG441           GGCCCGGT PPDB Motif  PLACE Motif 
REGGGTCCACG+20285902028597-199-192
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGAGTGGGCCGGCCCATG+20286302028645-159-144
 OsREG478AGTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG490       CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517        GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCCCCCGCGTGGG+20286682028679-121-110
 OsREG537CCCCCGCG     PPDB Motif  PLACE Motif 
 OsREG530    CGCGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.