version
PlantPromoterDB promoter information of AK072544

Summary of Gene (AK072544)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0752300        NCBI 
Gene model AK072544  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 2: 32514514-32513315)

Genome position     
from initiation codon
J023132N16          
J033069F17          
TSS from cDNA
TSS information
AK072544                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072544

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-32514432-918

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCC-3251440232514410-888-896
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGCCCAAAT-3251449432514504-980-990
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCGCGACGCG-3251450632514514-992-1000
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGCCCACCACGTGTCACT-3251457632514591-1062-1077
 OsREG527CCCACCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG434    CCACGTGT     PPDB MotifACGT  PLACE Motif 
 OsREG509     CACGTGTC    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG477        GTGTCACT PPDB Motif  PLACE MotifTGAC 
REGAACGGCCCAACC-3251466532514676-1151-1162
 OsREG423AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595    GCCCAACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.