version
PlantPromoterDB promoter information of AK072707

Summary of Gene (AK072707)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0817500        NCBI 
Gene model AK072707  
Description KCNAB voltage-gated K+ channel, beta subunit family protein.  
#
#

Overview

Focused view (chromosome 2: 35953944-35955143)

Genome position     
from initiation codon
006-041-H01         
AK104135            
J023039B19          
J023068P07          
J023132N10          
J023134D18          
J023139I11          
J033073C13          
J065075D20          
J065084M04          
J065166L18          
J065204L01          
J090067H20          
J100089J07          
U46758              
TSS from cDNA
TSS information
AK072707                         5'->3' (+)
Promoter sequence







 
AK110894            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072707

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35954881-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTC+3595485035954857-94-87
Y PatchTCTCTCTCTC+3595486035954869-84-75
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACAC+3595461535954622-329-322
 OsREG535CCCCACAC PPDB Motif  PLACE Motif 
REGATGGCCCACCTGTC+3595464735954660-297-284
 OsREG487ATGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG514    CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436     CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501      CACCTGTC PPDB Motif  PLACE Motif 
REGCGGGCCCCACCAC+3595470635954718-238-226
 OsREG567CGGGCCCC      PPDB MotifACGGGC  PLACE Motif 
 OsREG641 GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631  GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612   GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG527     CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGGCCCC+3595473735954750-207-194
 OsREG501GACAGGTG       PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG      PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647      TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGCCACCTGTC+3595476335954771-181-173
 OsREG436CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501 CACCTGTC PPDB Motif  PLACE Motif 
REGGACACGTG+3595477535954782-169-162
 OsREG509GACACGTG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.