version
PlantPromoterDB promoter information of AK072797

Summary of Gene (AK072797)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0104100        NCBI 
Gene model AK072797  
Description Zinc finger, RING-type domain containing protein.  
#
#

Overview

Focused view (chromosome 1: 208283-209482)

Genome position     
from initiation codon
AK104280            
J023139M11          
J043005H01          
J065168C08          
J075054J11          
J075176C13          
J075196E18          
J090069K05          
TSS from cDNA
TSS information
AK072797                         5'->3' (+)
Promoter sequence











 
011-057-C05         
016-024-D06         
AK072087            
AK103808            
J013025I15          
J033092F12          
J033147A10          
J065041K04          
J065112J02          
J065203P03          
J090006L10          
J090056C14          
J090086D12          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072797

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+208771-512
TSS clone peakGclone+208794-489

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCCTCCC+208736208751-547-532
Y PatchTCCCCTCTC+208796208804-487-479
Y PatchCTCTCCTCTCCCTCTC+208826208841-457-442
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG+208531208538-752-745
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGGTGGTGGG+208623208630-660-653
 OsREG527GTGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCT+208654208662-629-621
 OsREG422AAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCAACA+208664208674-619-609
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCTTCTGTGGGCCTA+208682208702-601-581
 OsREG605TTATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG627           TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472            GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656             TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGCGGTGCGTCGCGTC+208723208737-560-546
 OsREG554GCGGTGCG        PPDB Motif  PLACE Motif 
 OsREG556     GCGTCGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583       GTCGCGTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-208606AK103808, AK072087, AK103808
TSS clone peakGclone-208581AK103808, AK072087, AK103808

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTT-208587208594AK072087, AK103808
Y PatchCTTCCTCCC-208607208615AK072087, AK103808
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCACCAC-208623208630AK072087, AK103808
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATTT-208654208662AK072087, AK103808
 OsREG432AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422 GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCGA-208664208674AK072087, AK103808
 OsREG594TGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCACAGAAGCCCATAA-208682208702AK072087, AK103808
 OsREG656TAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA            PPDB MotifGCCCA  PLACE Motif 
 OsREG582          GAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429           AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465            AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605             GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGACGCGACGCACCGC-208723208737AK072087, AK103808
 OsREG583GACGCGAC        PPDB Motif  PLACE Motif 
 OsREG556  CGCGACGC      PPDB Motif  PLACE MotifCGACG 
 OsREG554       CGCACCGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.