version
PlantPromoterDB promoter information of AK072820

Summary of Gene (AK072820)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0332700        NCBI 
Gene model AK072820  
Description Similar to ABC Transporter, ATP binding component.  
#
#

Overview

Focused view (chromosome 3: 12331762-12330563)

Genome position     
from initiation codon
J023135H16          
J065043K21          
J065070J12          
J065184D23          
J090063D10          
J090088K17          
J100061I07          
TSS from cDNA
TSS information
AK072820                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072820

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-12330806-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCCTCCC-1233076312330775-1-13
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGGCCCATAA-1233086212330874-100-112
 OsREG420AAACGGCC      PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423 AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630    GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605     GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATTAGGCCCATAA-1233091312330932-151-170
 OsREG655TAAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT           PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA          PPDB MotifGCCCA  PLACE Motif 
 OsREG656         TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474          AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630           GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605            GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAAAA-1233094812330955-186-193
 OsREG592GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.