version
PlantPromoterDB promoter information of AK072887

Summary of Gene (AK072887)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0717400        NCBI 
Gene model AK072887  
Description Pseudouridine synthase, Rlu family protein.  
#
#

Overview

Focused view (chromosome 6: 31363232-31362033)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK072887                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072887

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-31362252-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCCC-3136224031362249-8-17
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCCGGCCCATTT-3136230331362319-71-87
 OsREG615GCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG544  CGGCCCGG        PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490       CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431        GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422         GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGTGTGGGGGGT-3136232831362338-96-106
 OsREG535GTGTGGGG    PPDB Motif  PLACE Motif 
 OsREG438   TGGGGGGT PPDB Motif  PLACE Motif 
REGTCCGGCCC-3136234431362351-112-119
 OsREG644TCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGTGTGTG-3136251331362520-281-288
 OsREG499GGTGTGTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.