version
PlantPromoterDB promoter information of AK072904

Summary of Gene (AK072904)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0256200        NCBI 
Gene model AK072904  
Description RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.  
#
#

Overview

Focused view (chromosome 7: 8838585-8839784)

Genome position     
from initiation codon
J023148I23          
TSS from cDNA
TSS information
AK072904                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK072904

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+8839429-156

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTGGGCTGGGCT+88392758839287-310-298
 OsREG464GCTGGGCTGGGCT PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CTGGGCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG523  TGGGCTGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG533   GGGCTGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GGCTGGGC  PPDB MotifGCCCA  PLACE Motif 
REGGGACCCACTGAC+88392958839306-290-279
 OsREG622GGACCCAC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG522    CCACTGAC PPDB Motif  PLACE MotifTGAC 
REGCCCACGAA+88393118839318-274-267
 OsREG529CCCACGAA PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCCACAA+88393428839354-243-231
 OsREG614GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542  CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564   CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597     GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCTA+88393578839367-228-218
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.