version
PlantPromoterDB promoter information of AK073043

Summary of Gene (AK073043)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0687300        NCBI 
Gene model AK073043  
Description Similar to SNF1 kinase complex anchoring protein (Fragment).  
#
#

Overview

Focused view (chromosome 7: 29865714-29864515)

Genome position     
from initiation codon
Os07g0687400        
TSS from cDNA
TSS information
AK073043                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073043

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-29864715-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTGTATATAA-2986474929864758-35-44
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCTTAGGCCCATT-2986478129864799-67-85
 OsREG422AAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA         PPDB MotifGCCCA  PLACE Motif 
 OsREG656         TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474          AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431           GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCCATAA-2986480629864819-92-105
 OsREG493ATTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630     GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605      GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTTTCGGCCCAACA-2986482329864835-109-121
 OsREG634TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626    GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594     GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCAAAC-2986484929864859-135-145
 OsREG496CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.