version
PlantPromoterDB promoter information of AK073151

Summary of Gene (AK073151)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0481100        NCBI 
Gene model AK073151  
Description Similar to RNA helicase.  
#
#

Overview

Focused view (chromosome 12: 17840640-17839441)

Genome position     
from initiation codon
AK099385            
J090075I16          
TSS from cDNA
TSS information
AK073151                         5'->3' (-)
Promoter sequence










 
AK102011            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073151

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-17839641-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTCCCCC-1783965617839668-16-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGGCCCACGAAAGCCCATCA-1783968717839708-47-68
 OsREG584GACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA              PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564  CGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG            PPDB MotifGCCCA  PLACE Motif 
 OsREG601    GCCCACGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG529     CCCACGAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG421           AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429            AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466             AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607              GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCCAACT-1783974217839753-102-113
 OsREG615GCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479    GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCATTA-1783975617839767-116-127
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610    GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGGGCGTGGA-1783979317839800-153-160
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 
REGCGACCCGC-1783989817839905-258-265
 OsREG552CGACCCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.