version
PlantPromoterDB promoter information of AK073266

Summary of Gene (AK073266)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0548300        NCBI 
Gene model AK073266  
Description Zinc finger, RING-type domain containing protein.  
#
#

Overview

Focused view (chromosome 8: 27589402-27590601)

Genome position     
from initiation codon
J013030C19          
J033029A20          
J033050L14          
J033058F03          
J033110K01          
J033123D21          
TSS from cDNA
TSS information
AK073266                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073266

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+27590333-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTCC+2759033927590346-63-56
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGCCGTTT+2759005627590068-346-334
 OsREG607TGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423    GGGCCGTT  PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG420     GGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGGTGGGACCCA+2759009927590108-303-294
 OsREG650GTGGGACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637  GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGCCCAGCCCACCAC+2759026127590273-141-129
 OsREG533CCCAGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG462   AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527     CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.