version
PlantPromoterDB promoter information of AK073337

Summary of Gene (AK073337)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0251800        NCBI 
Gene model AK073337  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 8058334-8057135)

Genome position     
from initiation codon
AK067333            
J033025I20          
TSS from cDNA
TSS information
AK073337                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073337

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-8057429-95

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCC-80574448057451-110-117
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGTCAC-80574958057505-161-171
 OsREG448CGCCACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGTCCGGCCCAGCCCAGC-80576198057634-285-300
 OsREG644TCCGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG       PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG523      CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG512       CAGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG464        AGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-80576868057693-352-359
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.