version
PlantPromoterDB promoter information of AK073387

Summary of Gene (AK073387)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0238700        NCBI 
Gene model AK073387  
Description Similar to Acid phosphatase type 5.  
#
#

Overview

Focused view (chromosome 3: 7379156-7377957)

Genome position     
from initiation codon
003-103-F02         
J013042E23          
J023075J16          
J033043K11          
TSS from cDNA
TSS information
AK073387                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073387

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-7378181-25

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCACAC-73782217378228-65-72
 OsREG598GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGTCGTGGGCCGCAGGCCCGCA-73782327378251-76-95
 OsREG601TCGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG           PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG643    GGGCCGCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG632            GGCCCGCA PPDB Motif  PLACE Motif 
REGCGGCTCGG-73782757378282-119-126
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 
REGATATGGGCCGGATGGGCCTTG-73783067378326-150-170
 OsREG480ATATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG           PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG608         GGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590          GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           ATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG430            TGGGCCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG497             GGGCCTTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.