version
PlantPromoterDB promoter information of AK073399

Summary of Gene (AK073399)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0573000        NCBI 
Gene model AK073399  
Description Protein prenyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 9: 23747844-23749043)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK073399                         5'->3' (+)
Promoter sequence









 
011-095-F08         
AK069270            
J013050G19          
J013149G04          
J023013P18          
J023110E02          
J033116G16          
J065177M22          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073399

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+23748751-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCACGCC+2374846123748468-383-376
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGGGGGCCCACTTG+2374849423748505-350-339
 OsREG647GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498    CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCGAGAGGCCCACGA+2374854123748561-303-283
 OsREG581CTTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA            PPDB MotifGCCCA  PLACE Motif 
 OsREG575   GGGCCGAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG635    GGCCGAGA          PPDB Motif  PLACE Motif 
 OsREG587          GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472           AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571            GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601             GCCCACGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-23748372AK069270, AK069270

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCGTGGA-2374846123748468AK069270
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 
REGCAAGTGGGCCCC-2374849423748505AK069270
 OsREG498CAAGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGTCGTGGGCCTCTCGGCCCAAG-2374854123748561AK069270
 OsREG601TCGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG635         TCTCGGCC     PPDB Motif  PLACE Motif 
 OsREG575          CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658           TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563            CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581             GGCCCAAG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.