version
PlantPromoterDB promoter information of AK073460

Summary of Gene (AK073460)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0296400        NCBI 
Gene model AK073460  
Description Similar to Eukaryotic translation initiation factor 2 subunit 1 (Eukaryotic translation initiation factor 2 alpha subunit) (eIF-2-alpha) (EIF- 2alpha) (EIF-2A) (Fragment).  
#
#

Overview

Focused view (chromosome 3: 10422666-10423865)

Genome position     
from initiation codon
006-084-H11         
AK104149            
AK105818            
J033032P10          
J033039F21          
J033040F15          
J033057O12          
J033106A08          
J033119F09          
J043017A16          
J053064E18          
J053082H12          
J053098L08          
J065009I10          
J065115J24          
J065117N15          
J075024D01          
J075069J05          
J090002L15          
J090008I18          
J090031M09          
J090039H14          
J090048H16          
J090070A16          
J090082C07          
J100036B12          
J100067N13          
J100073D04          
TSS from cDNA
TSS information
AK073460                         5'->3' (+)
Promoter sequence




 
014-009-B08         
AK100042            
J013152C17          
J065082N10          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073460

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+10423475-191
TSS clone peakCclone+10423558-108

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCCC+1042350310423510-163-156
Y PatchCCTCTCTCC+1042356610423574-100-92
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGATCGG+1042326110423268-405-398
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGGAGACGTG+1042342310423430-243-236
 OsREG506GAGACGTG PPDB MotifACGT  PLACE Motif 
REGCCGTCCGATCCG+1042347310423484-193-182
 OsREG545CCGTCCGA     PPDB Motif  PLACE Motif 
 OsREG484 CGTCCGAT    PPDB Motif  PLACE Motif 
 OsREG589  GTCCGATC   PPDB Motif  PLACE Motif 
 OsREG541    CCGATCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-10423256AK100042, AK100042

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTCTCC-1042324510423256AK100042
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCACGTCTC-1042342310423430AK100042
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 
REGCGGATCGGACGG-1042347310423484AK100042
 OsREG541CGGATCGG     PPDB Motif  PLACE Motif 
 OsREG589  GATCGGAC   PPDB Motif  PLACE Motif 
 OsREG484   ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545    TCGGACGG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.