version
PlantPromoterDB promoter information of AK073636

Summary of Gene (AK073636)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0725300        NCBI 
Gene model AK073636  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 30241306-30242505)

Genome position     
from initiation codon
011-085-E09         
016-060-F02         
AK063969            
AK106493            
J033050L15          
J053082G03          
J075083C18          
J075087E04          
TSS from cDNA
TSS information
AK073636                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073636

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+30242147-159
TSS clone peakAclone+30242183-123

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCCTCCCC+3024221030242223-96-83
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATGGGCTTC+3024195030241960-356-346
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACAA+3024198430241992-322-314
 OsREG461AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597 GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGGTATGGGCCAA+3024202330242033-283-273
 OsREG606GTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCACGAA+3024207830242089-228-217
 OsREG656TAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG601   GCCCACGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG529    CCCACGAA PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCCATA+3024210930242119-197-187
 OsREG643TGCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.