version
PlantPromoterDB promoter information of AK073687

Summary of Gene (AK073687)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0545800        NCBI 
Gene model AK073687  
Description Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.  
#
#

Overview

Focused view (chromosome 11: 21994761-21993562)

Genome position     
from initiation codon
J090050C14          
TSS from cDNA
TSS information
AK073687                         5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073687

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-21993926-165

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACGGCCCACCAAGCCCATCCA-2199397621993998-215-237
 OsREG521CCACGGCC                PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA              PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC            PPDB MotifGCCCA  PLACE Motif 
 OsREG599     GCCCACCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG519          CCAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG496           CAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG429            AAGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG466             AGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608              GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534               CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAGTT-2199401321994023-252-262
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAGCCC-2199403221994043-271-282
 OsREG523CCAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.