version
PlantPromoterDB promoter information of AK073783

Summary of Gene (AK073783)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0166800        NCBI 
Gene model AK073783  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 3429496-3428297)

Genome position     
from initiation codon
AK099378            
J033026H10          
J033067O18          
J033108A17          
J065015J11          
J065204P09          
TSS from cDNA
TSS information
AK073783                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073783

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-3428573-77

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGCTATAA-34285943428602-98-106
Y PatchCTCCTCTCC-34285853428593-89-97
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGACGGCCCATTAGGCCCAATA-34287013428722-205-226
 OsREG624GGACGGCC               PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA             PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG431    GGCCCATT           PPDB MotifGCCCA  PLACE Motif 
 OsREG610     GCCCATTA          PPDB MotifGCCCA  PLACE Motif 
 OsREG656           TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471            AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492             GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596              GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGCA-34287413428748-245-252
 OsREG643GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGATCTCGGCCCGGC-34287693428781-273-285
 OsREG485ATCTCGGC      PPDB Motif  PLACE Motif 
 OsREG635 TCTCGGCC     PPDB Motif  PLACE Motif 
 OsREG575  CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG568   TCGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544    CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG616     GGCCCGGC PPDB Motif  PLACE Motif 
REGATATGGGCCGGA-34287853428796-289-300
 OsREG480ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.