PlantPromoterDB promoter information of AK073802

Summary of Gene (AK073802)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0641600        NCBI 
Gene model AK073802  
Description NONE  


Focused view (chromosome 7: 27366340-27365141)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AK073802                         5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of AK073802

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakGclone-27365399-59

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+27366060AF009413, J100063M21, J065115D21, J100056A20, J075083P05, 014-030-D10, 009-030-F09, J065062M22, J065071L10, AK119728, AK122129, J033132M21, J075011B03, J075011K23, J075029J17, J075038J07, J075065A18, J075101G24, J075127E19, J075161K23, J075175D23, J090065J11, J090097M02, J090065G16, J065187D07, J023143P09, J090044M07, J090099D02, J065039D07, J065088N13, AF009413, J023057A19, AK059154

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGAAATGGGCCGTGGAGGTGGGCCGGT+2736592627365950009-030-F09, 014-030-D10, AF009413, AK059154, AK119728, AK122129, J023057A19, J023143P09, J033132M21, J065039D07, J065062M22, J065071L10, J065088N13, J065115D21, J065187D07, J075011B03, J075011K23, J075029J17, J075038J07, J075065A18, J075083P05, J075101G24, J075127E19, J075161K23, J075175D23, J090044M07, J090065G16, J090065J11, J090097M02, J090099D02, J100056A20, J100063M21
 OsREG422AAATGGGC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT               PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG              PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG             PPDB Motif  PLACE Motif 
 OsREG476             AGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564               GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542                TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440                 GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGCGCGTCGC+2736601127366018009-030-F09, 014-030-D10, AF009413, AK059154, AK119728, AK122129, J023057A19, J023143P09, J033132M21, J065039D07, J065062M22, J065071L10, J065088N13, J065115D21, J065187D07, J075011B03, J075011K23, J075029J17, J075038J07, J075065A18, J075083P05, J075101G24, J075127E19, J075161K23, J075175D23, J090044M07, J090065G16, J090065J11, J090097M02, J090099D02, J100056A20, J100063M21

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.