version
PlantPromoterDB promoter information of AK073815

Summary of Gene (AK073815)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0471900        NCBI 
Gene model AK073815  
Description Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein.  
#
#

Overview

Focused view (chromosome 9: 18666088-18667287)

Genome position     
from initiation codon
J013098K19          
J023090O18          
J033065D05          
J090099P11          
TSS from cDNA
TSS information
AK073815                         5'->3' (+)
Promoter sequence









 
                    
Os09g0471866        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073815

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+18666932-156

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCCTC+1866689918666911-189-177
Y PatchTCCTCCTCCTCCCC+1866692518666938-163-150
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGGGAC+1866665618666663-432-425
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGGGGACCCA+1866666518666672-423-416
 OsREG637GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGCAAGGCCCAACA+1866676418666775-324-313
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471  AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGC+1866677918666786-309-302
 OsREG596TATTGGGC PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCCATAA+1866682618666838-262-250
 OsREG478AGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489   GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630    GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605     GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCTCCAGCCCACACG+1866685018666868-238-220
 OsREG560CGCGTCTC            PPDB Motif  PLACE Motif 
 OsREG523       CCAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG461         AGCCCACA   PPDB MotifGCCCA  PLACE Motif 
 OsREG598          GCCCACAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG526           CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCCAACT+1866687118666883-217-205
 OsREG614GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542  CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626    GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479     GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.