version
PlantPromoterDB promoter information of AK073875

Summary of Gene (AK073875)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0556700        NCBI 
Gene model AK073875  
Description T-complex 11 family protein.  
#
#

Overview

Focused view (chromosome 2: 21915485-21916684)

Genome position     
from initiation codon
011-008-G02         
AK066869            
J023063M16          
J033074B12          
J033076K24          
J033112L13          
TSS from cDNA
TSS information
AK073875                         5'->3' (+)
Promoter sequence

 
009-039-H05         
AK062454            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073875

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+21912313-122

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTCTCTCTCTCTCCCC+2191226421912285-171-150
Y PatchCTCTCCCC+2191234821912355-87-80
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGTCCGATC+2191212221912133-313-302
 OsREG624GGCCGTCC     PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC PPDB Motif  PLACE Motif 
REGATCCAACGGCC+2191215121912161-284-274
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494   CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGCATCCACC+2191217321912180-262-255
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGGCCCACCC+2191218521912192-250-243
 OsREG600GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGCACTGACACGTGGGCCCCACGCCTC+2191224321912267-192-168
 OsREG510CACTGACA                  PPDB Motif  PLACE MotifTGAC 
 OsREG509    GACACGTG              PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434     ACACGTGG             PPDB MotifACGT  PLACE Motif 
 OsREG508      CACGTGGG            PPDB MotifACGT  PLACE Motif 
 OsREG449       ACGTGGGC           PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571        CGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG572             GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG503                 CACGCCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.