version
PlantPromoterDB promoter information of AK073882

Summary of Gene (AK073882)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0424600        NCBI 
Gene model AK073882  
Description HAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein.  
#
#

Overview

Focused view (chromosome 9: 16053485-16054684)

Genome position     
from initiation codon
J033026O07          
J033073D14          
J033132K08          
J065197G18          
J075033A14          
J075076M13          
J075194K19          
TSS from cDNA
TSS information
AK073882                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK073882

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+16054428-57

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCCCT+1605445216054460-33-25
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGCCCGGG+1605412916054137-356-348
 OsREG544CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG539 GGCCCGGG PPDB Motif  PLACE Motif 
REGTCCGGGCCGTG+1605414816054158-337-327
 OsREG633TCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446  CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504   GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGTATGGGCCGCA+1605417616054186-309-299
 OsREG630TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643   GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCGCA+1605419316054204-292-281
 OsREG605TTATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643    GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGCCCGGGCC+1605421816054225-267-260
 OsREG539CCCGGGCC PPDB Motif  PLACE Motif 
REGGCCCACGGG+1605426416054272-221-213
 OsREG547GCCCACGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG531 CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGGCCACACG+1605429016054297-195-188
 OsREG573GCCACACG PPDB Motif  PLACE Motif 
REGCTGGGGCCCACGA+1605433116054343-154-142
 OsREG580CTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601     GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGACAGGTGGGCCCCACGTGGC+1605436516054384-120-101
 OsREG436ACAGGTGG             PPDB Motif  PLACE Motif 
 OsREG514 CAGGTGGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG476  AGGTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647     TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641      GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631       GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG572        GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450         CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508          CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG507            CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.