version
PlantPromoterDB promoter information of AK098864

Summary of Gene (AK098864)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0320500        NCBI 
Gene model AK098864  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 12519796-12520995)

Genome position     
from initiation codon
004-013-F05         
006-021-B06         
006-021-D12         
006-022-A12         
006-024-B10         
006-029-F07         
006-029-H12         
006-031-A05         
006-033-C03         
006-036-B12         
006-048-C08         
006-050-F03         
006-051-C12         
006-054-C03         
006-057-D12         
006-067-F01         
006-071-G12         
006-072-G11         
006-072-H01         
006-081-E02         
006-082-A11         
006-084-A04         
006-085-C08         
006-086-D03         
006-088-B05         
006-088-G02         
006-092-G10         
006-094-D11         
006-094-E04         
006-103-G12         
006-106-G08         
006-111-E06         
006-114-C07         
006-115-A04         
006-117-G11         
006-118-G09         
009-010-F03         
009-076-G01         
009-134-E10         
AF094776            
AK060904            
J013001A03          
J013098P14          
J013127B16          
J013169J24          
J023084H23          
J023093F05          
J033041I05          
J065196G15          
J075019K01          
J075053H16          
J075055M09          
J075099G10          
J075099L23          
J075127I09          
J080001C14          
J080016B11          
J080029C14          
J080029I17          
J080034F13          
J080039E02          
J080040N05          
J080042O17          
J080043N15          
J080056K02          
J080063N15          
J080069H05          
J080070N15          
J080075J22          
J080076F12          
J080086G05          
J090046G07          
J090059H01          
J090099C09          
J100028E12          
J100048J04          
J100054O05          
J100062C09          
J100075C17          
J100075C23          
J100075I23          
TSS from cDNA
TSS information
AK098864                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK098864

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+12520709-87
TSS clone peakGclone+12520712-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAGC+1252047712520486-319-310
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGGATCCGACGTGGCCCAAT+1252055912520576-237-220
 OsREG588GATCCGAC           PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG          PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG585     GACGTGGC      PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG653        GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG659         TGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492          GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGC+1252057912520586-217-210
 OsREG600GGGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGATCCCCCA+1252062712520634-169-162
 OsREG482ATCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.