version
PlantPromoterDB promoter information of AK098953

Summary of Gene (AK098953)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0577200        NCBI 
Gene model AK098953  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 21867739-21868938)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK098953                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK098953

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+21868960-129
TSS clone peakGclone+21868968-121
TSS cloneGclone+21868972-117
TSS cloneGclone+21868976-113

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCCTCTC+2186900421869016-85-73
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGACGGACGGATCGG+2186871221868726-377-363
 OsREG623GGACGGAC        PPDB Motif  PLACE Motif 
 OsREG561   CGGACGGA     PPDB Motif  PLACE Motif 
 OsREG541       CGGATCGG PPDB Motif  PLACE Motif 
REGCCCATCCACC+2186885421868863-235-226
 OsREG534CCCATCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG515  CATCCACC PPDB Motif  PLACE Motif 
REGATCCGACGGCCCAGG+2186887721868891-212-198
 OsREG483ATCCGACG        PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG       PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584    GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445     ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565      CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550       GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGCTCCCCCA+2186891321868920-176-169
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.