version
PlantPromoterDB promoter information of AK098968

Summary of Gene (AK098968)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0712200        NCBI 
Gene model AK098968  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 29534049-29535248)

Genome position     
from initiation codon
AK073205            
TSS from cDNA
TSS information
AK098968                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK098968

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+29535017-32
TSS clone peakGclone+29535023-26

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAGGTGGGGGC+2953472929534739-320-310
 OsREG514CAGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG613   GTGGGGGC PPDB Motif  PLACE Motif 
REGGTGGTGGGGCCCAAC+2953474729534761-302-288
 OsREG527GTGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG639      GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG626       GGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGAAAAGCCCAAT+2953488329534893-166-156
 OsREG419AAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG460   AGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCAAAC+2953490829534918-141-131
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCCGGTTGGGCCAG+2953493029534950-119-99
 OsREG425AACTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG           PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543    GGGCCCGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG441     GGCCCGGT         PPDB Motif  PLACE Motif 
 OsREG595          GGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626           GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG659            TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577             TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGACCGGGCCGGG+2953495929534969-90-80
 OsREG441ACCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG538   GGGCCGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.