version
PlantPromoterDB promoter information of AK098973

Summary of Gene (AK098973)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0397900        NCBI 
Gene model AK098973  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 19043989-19045188)

Genome position     
from initiation codon
006-033-G02         
009-131-F03         
AK060114            
AK109817            
J013089E18          
J075031N03          
J100073C12          
J100081N17          
TSS from cDNA
TSS information
AK098973                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK098973

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+19044809-180
TSS clone peakCclone+19044894-95
TSS cloneAclone+19044916-73

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCCTCCTCCTC+1904487719044896-112-93
Y PatchTCCTCCTCCCTCTCCCC+1904491719044933-72-56
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTGGGCCCACA+1904469019044701-299-288
 OsREG640 GTGGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627TGTGGGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGGGACCCA+1904470719044714-282-275
 OsREG637GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGCTCTCCGC+1904473719044744-252-245
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGCCCACGTG+1904474619044753-243-236
 OsREG508CCCACGTG PPDB MotifACGT  PLACE Motif 
REGAGAGTGGGCCCCACGCG+1904481619044832-173-157
 OsREG455AGAGTGGG          PPDB Motif  PLACE Motif 
 OsREG478  AGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572       GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530         CCCACGCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.