version
PlantPromoterDB promoter information of AK098977

Summary of Gene (AK098977)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0240300        NCBI 
Gene model AK098977  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 7821663-7822862)

Genome position     
from initiation codon
AK072205            
J100044D02          
TSS from cDNA
TSS information
AK098977                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK098977

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+7822369-294
TSS clone peakCclone+7822384-279

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCTCCT+78223847822394-279-269
Y PatchTCCCCCTC+78224257822432-238-231
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACTTG+78221667822173-497-490
 OsREG498CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGCACGTCAC+78221837822190-480-473
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGGCCCCACCTGTC+78221937822205-470-458
 OsREG631GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG612 GCCCCACC     PPDB Motif  PLACE Motif 
 OsREG514   CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436    CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501     CACCTGTC PPDB Motif  PLACE Motif 
REGGCCCCCAC+78222217822228-442-435
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGGACGTGGCCCCACCTG+78222467822261-417-402
 OsREG585GACGTGGC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCGCGCGACGC+78222717822280-392-383
 OsREG557CGCGCGAC   PPDB MotifACGCGC  PLACE Motif 
 OsREG556  CGCGACGC PPDB Motif  PLACE MotifCGACG 
REGAGGTGGGCCCCACGTG+78222897822304-374-359
 OsREG476AGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG450       CCCCACGT  PPDB MotifACGT  PLACE Motif 
 OsREG508        CCCACGTG PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.