version
PlantPromoterDB promoter information of AK098990

Summary of Gene (AK098990)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0388500        NCBI 
Gene model AK098990  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 18794267-18795466)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK098990                         5'->3' (+)
Promoter sequence

 
                    
Os05g0388433        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK098990

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+18796456-61
TSS clone peakCclone+18796462-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCCCCTT+1879645018796460-67-57
Y PatchTCTCCTCCCCCCTCCCC+1879648218796498-35-19
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCCAATCCGACG+1879621218796230-305-287
 OsREG592TTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCCAA        PPDB MotifGCCCA  PLACE Motif 
 OsREG492     GGCCCAAT       PPDB MotifGCCCA  PLACE Motif 
 OsREG483           ATCCGACG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCTCCCCCA+1879625518796262-262-255
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGCCCCCGCG+1879627018796277-247-240
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCGGCTCGG+1879629218796299-225-218
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 
REGAGCCCAAAT+1879631218796320-205-197
 OsREG457AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493 GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCGACGCGCGAG+1879634018796356-177-161
 OsREG537CCCCCGCG          PPDB Motif  PLACE Motif 
 OsREG556    CGCGACGC      PPDB Motif  PLACE MotifCGACG 
 OsREG559     GCGACGCG     PPDB Motif  PLACE MotifCGACG 
 OsREG558         CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGCCTCGCCC+1879639618796403-121-114
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.