version
PlantPromoterDB promoter information of AK099008

Summary of Gene (AK099008)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0612600        NCBI 
Gene model AK099008  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 31468274-31467075)

Genome position     
from initiation codon
006-062-E06         
AB042115            
AK060707            
AK104427            
J013120E14          
J023037M01          
J023039O03          
J023043H02          
J023083N16          
J033033I23          
J033067P21          
J033088M21          
J033133M08          
J043030I16          
J053090J10          
J075012H13          
J075020G19          
J075049H08          
TSS from cDNA
TSS information
AK099008                         5'->3' (-)
Promoter sequence









 
AK102452            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099008

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-31467406-132
TSS clone peakAclone-31467404-130
TSS cloneGclone-31467379-105

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTATAAATA-3146743031467438-156-164
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAAT-3146744831467457-174-183
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGAACGGGCCAGA-3146746331467473-189-199
 OsREG424AACGGGCC    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG638   GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTCCGACGGGCCCACCT-3146747731467492-203-218
 OsREG546TCCGACGG         PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG566     CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640      GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476        GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCAAACAATGGGCCCACCT-3146750431467527-230-253
 OsREG430AAGGCCCA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA                PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA               PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC              PPDB MotifGCCCA  PLACE Motif 
 OsREG431           AATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489            ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640              GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628               GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476                GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCACT-3146753631467545-262-271
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.