version
PlantPromoterDB promoter information of AK099065

Summary of Gene (AK099065)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0678800        NCBI 
Gene model AK099065  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 35063982-35065181)

Genome position     
from initiation codon
003-128-H09         
006-025-E03         
006-034-E01         
006-044-G04         
006-057-A11         
006-064-F05         
006-074-D05         
006-075-C10         
006-075-D07         
006-079-E10         
006-086-A08         
006-088-E04         
006-092-G05         
006-097-C10         
006-099-D04         
006-100-A11         
006-106-C04         
006-110-F03         
006-112-H08         
009-005-C10         
009-125-D08         
009-149-D04         
009-150-E07         
AK065236            
AK072212            
AK103940            
AK103943            
AK104855            
J013002H23          
J013039H21          
J013042N03          
J013157L05          
J023013E06          
TSS from cDNA
TSS information
AK099065                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099065

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+35064801-181
TSS clone peakGclone+35064840-142

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTGGGCT+3506466935064677-313-305
 OsREG599TGGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG462 GGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCAGTA+3506469035064701-292-281
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473  AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604    GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGACCGGCCCGTT+3506471135064721-271-261
 OsREG440ACCGGCCC    PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAAATGGGCCGA+3506473135064741-251-241
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGCTGGCCCATTA+3506474835064758-234-224
 OsREG577CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.