version
PlantPromoterDB promoter information of AK099445

Summary of Gene (AK099445)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0643300        NCBI 
Gene model AK099445  
Description Similar to AER123Wp.  
#
#

Overview

Focused view (chromosome 3: 25579190-25577991)

Genome position     
from initiation codon
AK108010            
TSS from cDNA
TSS information
AK099445                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099445

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-25578369-179
TSS clone peakGclone-25578339-149

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCTT-2557829125578299-101-109
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCACGCCCACGCCCACGCCCACGGCCCACGG-2557845125578483-261-293
 OsREG602GCCCACGCCCACGCCCACGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG547                  GCCCACGGCCCACGG PPDB MotifGCCCA  PLACE Motif 
 OsREG521                    CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504                     CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445                      ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564                       CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571                        GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
REGCCCACACG-2557848925578496-299-306
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCCCACCAC-2557852125578535-331-345
 OsREG478AGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG527       CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCAAGTGGGCCCAGA-2557857425578587-384-397
 OsREG498CAAGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579     GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629      GGCCCAGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.