version
PlantPromoterDB promoter information of AK099530

Summary of Gene (AK099530)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0168200        NCBI 
Gene model AK099530  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 3: 3658548-3659747)

Genome position     
from initiation codon
011-071-C08         
TSS from cDNA
TSS information
AK099530                         5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099530

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+3659436-112

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTGGGCT+36591613659168-387-380
 OsREG464GCTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCCCGGT+36591803659191-368-357
 OsREG624GGACGGCC     PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446  ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544   CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441    GGCCCGGT PPDB Motif  PLACE Motif 
REGTCAGCCCAGAT+36592063659216-342-332
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGGCCGAA+36592223659233-326-315
 OsREG611TGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG642    GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCCGTG+36592473659258-301-290
 OsREG607TGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCCAA+36592693659279-279-269
 OsREG479AGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATTT+36592893659297-259-251
 OsREG432AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422 GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.