version
PlantPromoterDB promoter information of AK099578

Summary of Gene (AK099578)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0152800        NCBI 
Gene model AK099578  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 6: 2726479-2725280)

Genome position     
from initiation codon
003-125-D04         
TSS from cDNA
TSS information
AK099578                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099578

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-2725539-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACTCC-27256032725610-124-131
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGGGTCCACG-27256262725633-147-154
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGCGCACCGC-27256482725655-169-176
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGTCCAACGGCT-27257402725749-261-270
 OsREG548TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG469  CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGAAAGCCCAACA-27257712725781-292-302
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCGGCCCAGG-27257842725800-305-321
 OsREG493ATTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565        CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550         GGCCCAGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.