version
PlantPromoterDB promoter information of AK099613

Summary of Gene (AK099613)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0155000        NCBI 
Gene model AK099613  
Description Brix domain containing protein.  
#
#

Overview

Focused view (chromosome 8: 3170470-3169271)

Genome position     
from initiation codon
004-001-C12         
014-030-C11         
AK060859            
J013050A14          
J013154C17          
J033039F14          
J033126I18          
J043005A17          
J053027C13          
J053033I07          
J053054P04          
J053060F22          
J053061P10          
J053065L13          
J053099H19          
J053101D09          
J075062C16          
J075129P09          
J075135C02          
J075147P13          
J090007K03          
J090050M06          
J090057M20          
J090070B06          
J090080D11          
J100021D15          
TSS from cDNA
TSS information
AK099613                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099613

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-3169556-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCTC-31695893169596-119-126
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACAC-31696073169644-137-174
 OsREG590 GATGGGCC                              PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                             PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                            PPDB MotifGCCCA  PLACE Motif 
 OsREG610         TAATGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG431          AATGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG488           ATGGGCCA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG660            TGGGCCAA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG519                CCAAGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG496                 CAAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG429                  AAGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG466                   AGCCCATC            PPDB MotifGCCCA  PLACE Motif 
 OsREG607TGATGGGC            GCCCATCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG497                          CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430                           AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472                            AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627                             GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598                              GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCTCGGCCCATAT-31696493169667-179-197
 OsREG605TTATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG575       CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658        TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490         CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630          GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480           GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCACCTG+31703383170345AK069865, AK104886, J013089M01, J023037M15, J033068E03, J090021P19
 OsREG514CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCGGGTGGGGCC+31703703170380AK069865, AK104886, J013089M01, J023037M15, J033068E03, J090021P19
 OsREG528CGGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC  PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC PPDB Motif  PLACE Motif 
REGGCCCATTA+31703913170398AK069865, AK104886, J013089M01, J023037M15, J033068E03, J090021P19
 OsREG610GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGTCACGCCTCGCCC+31704023170421AK069865, AK104886, J013089M01, J023037M15, J033068E03, J090021P19
 OsREG448CGCCACGT             PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC          PPDB MotifACGT  PLACE MotifTGAC 
 OsREG503        CACGCCTC     PPDB Motif  PLACE Motif 
 OsREG549            CCTCGCCC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.