version
PlantPromoterDB promoter information of AK099704

Summary of Gene (AK099704)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0478500        NCBI 
Gene model AK099704  
Description Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.  
#
#

Overview

Focused view (chromosome 8: 23689940-23688741)

Genome position     
from initiation codon
J013075H22          
TSS from cDNA
TSS information
AK099704                         5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099704

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-23689137-197

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGTGGG-2368937023689377-430-437
 OsREG526CGTGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCCACAC-2368938823689398-448-458
 OsREG566CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640 GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598   GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGGATCCGACGGCCCAGA-2368940523689420-465-480
 OsREG588GATCCGAC         PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG        PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546  TCCGACGG       PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584     GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445      ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565       CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629        GGCCCAGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.