version
PlantPromoterDB promoter information of AK099778

Summary of Gene (AK099778)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0568100        NCBI 
Gene model AK099778  
Description Similar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK).  
#
#

Overview

Focused view (chromosome 7: 23486316-23487515)

Genome position     
from initiation codon
J013095J08          
TSS from cDNA
TSS information
AK099778                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099778

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+23487104-212

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCCTCC+2348705823487067-258-249
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGACCCG+2348680723486814-509-502
 OsREG569GGGACCCG PPDB MotifGGGACCC  PLACE Motif 
REGCAAGCCCAGTT+2348690423486914-412-402
 OsREG496CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAACC+2348693323486943-383-373
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595   GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATT+2348695223486959-364-357
 OsREG432AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATGGGCCGA+2348696623486979-350-337
 OsREG467AGCCCATG       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525 GCCCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517    CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490     ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658      TGGGCCGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.