version
PlantPromoterDB promoter information of AK099923

Summary of Gene (AK099923)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0115700        NCBI 
Gene model AK099923  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 828570-827371)

Genome position     
from initiation codon
AK065094            
AK099231            
J013001M08          
J013028E02          
J013046I19          
J013049B01          
J013058I23          
J013066G23          
J013069G09          
J013102P12          
J013114F15          
J013119A15          
J013120N05          
J013121E06          
J013128C12          
J013134J19          
J013135F01          
J013149H10          
J013156A19          
J013160L04          
J013169K12          
J013169O19          
J023001A21          
J023007K05          
J023014E04          
J023023I24          
J023024M12          
J023030F04          
J023031H13          
J023034M03          
J023045N01          
J023056I16          
J023063D12          
J023068O16          
J023074I04          
J023075M06          
J023081P12          
J023082B22          
J023084L23          
J023087L03          
J023089F22          
J023090B20          
J023098J21          
J023100H16          
J023101A05          
J023101F19          
J023119A09          
J023119C22          
J023125D05          
J023127F19          
J023128N21          
J023129A17          
J023130A09          
J023130O09          
J023135F10          
J023146N07          
J023149B04          
J043009L01          
J043016E11          
J043036H06          
J053063H23          
J065061B12          
J065070P06          
J065123C22          
J065136J16          
J080030P12          
J090001I09          
J090010F19          
J090014F17          
J090015A11          
J090016G24          
J090017G24          
J090019B16          
J090019E11          
J090020B10          
J090021D07          
J090021G02          
J090027H21          
J090031K18          
J090032F02          
J090047D22          
J090050L12          
J090052N21          
J090055B20          
J090058B10          
J090058E06          
J090062F03          
J090063I05          
J090065H23          
J090065K23          
J090065L05          
J090067F10          
J090081A06          
J090081D17          
J090083L09          
J090083P08          
J090087K17          
J090088K10          
J090096K13          
J100017D23          
J100018I21          
J100024E16          
J100025E22          
J100025M09          
J100039B18          
J100039H22          
J100040F15          
J100042M01          
J100042P05          
J100059M01          
J100059P04          
J100065B20          
J100067B18          
J100070A20          
J100071F01          
J100083K09          
J100085O17          
J100086K08          
X61626              
TSS from cDNA
TSS information
AK099923                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099923

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-827640-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGCTATATAAC-827666827677-96-107
Y PatchCCCCTCTC-827608827615-38-45
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGGGCCCACCA-827740827752-170-182
 OsREG539CCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599     GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGGTGGGACCCA-827770827779-200-209
 OsREG650GTGGGACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637  GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGGGGGCCCACATCCACC-827804827819-234-249
 OsREG647GGGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC        PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA       PPDB MotifGCCCA  PLACE Motif 
 OsREG515        CATCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.