version
PlantPromoterDB promoter information of AK099931

Summary of Gene (AK099931)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0121000        NCBI 
Gene model AK099931  
Description Similar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS).  
#
#

Overview

Focused view (chromosome 2: 1096959-1095760)

Genome position     
from initiation codon
012-033-A04         
TSS from cDNA
TSS information
AK099931                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099931

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-1095969-10

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTGGGCTTTGTTGGGCCCC-10960461096067-87-108
 OsREG530CGCGTGGG               PPDB MotifGCCCA  PLACE Motif 
 OsREG602 GCGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG463  CGTGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG427   GTGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG421    TGGGCTTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG594           TGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626            GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG639             TTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647              TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCT-10960831096091-124-132
 OsREG594TGTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGGTGGGTCCCACCTGTCAGT-10961091096127-150-168
 OsREG622GTGGGTCC            PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC           PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA          PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC         PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG514      CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT     PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC    PPDB Motif  PLACE Motif 
 OsREG551          CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453           CTGTCAGT PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.