version
PlantPromoterDB promoter information of AK099962

Summary of Gene (AK099962)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0380900        NCBI 
Gene model AK099962  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 18415169-18413970)

Genome position     
from initiation codon
AK067214            
J065083M07          
TSS from cDNA
TSS information
AK099962                         5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099962

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-18414268-99
TSS clone peakTclone-18414267-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCTATATAA-1841429618414305-127-136
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACGCGT-1841431618414323-147-154
 OsREG443CCACGCGT PPDB Motif  PLACE Motif 
REGGCCCACGTGT-1841438518414394-216-225
 OsREG449GCCCACGT   PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508 CCCACGTG  PPDB MotifACGT  PLACE Motif 
 OsREG434  CCACGTGT PPDB MotifACGT  PLACE Motif 
REGCAGGTGGGCCCCACCTGTCAG-1841440918414429-240-260
 OsREG514CAGGTGGG CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612       GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG436          CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501           CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551             CCTGTCAG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.