version
PlantPromoterDB promoter information of AK099982

Summary of Gene (AK099982)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0558500        NCBI 
Gene model AK099982  
Description PWWP domain containing protein.  
#
#

Overview

Focused view (chromosome 1: 22794985-22796184)

Genome position     
from initiation codon
J013129G24          
J033044A12          
J033133I02          
J065096J12          
TSS from cDNA
TSS information
AK099982                         5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099982

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+22795715-270

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCCTCCTCCT+2279569522795712-290-273
Y PatchCTTCCTCCTCCCCC+2279572622795739-259-246
Y PatchCCCCCCCCTCCTCC+2279574322795756-242-229
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCGGACGGCC+2279554822795558-437-427
 OsREG484ATCGGACG    PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG   PPDB Motif  PLACE Motif 
 OsREG562  CGGACGGC  PPDB Motif  PLACE Motif 
 OsREG624   GGACGGCC PPDB Motif  PLACE Motif 
REGTAATGGGCTTTTGGGCCCAGCC+2279560422795625-381-360
 OsREG610TAATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT              PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT             PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG592        TTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625         TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639          TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579            GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG620             GGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603              GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAAT+2279563222795641-353-344
 OsREG618GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.