version
PlantPromoterDB promoter information of AK099987

Summary of Gene (AK099987)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0679800        NCBI 
Gene model AK099987  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 35114165-35115364)

Genome position     
from initiation codon
AK060662            
J013130B11          
J065049C17          
J075191N12          
J075191P12          
J100031C07          
TSS from cDNA
TSS information
AK099987                         5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK099987

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+35114619-546

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCC+3511457235114580-593-585
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTGGC+3511432835114335-837-830
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCGTGGGCCCCACG+3511435235114365-813-800
 OsREG547CCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG PPDB Motif  PLACE Motif 
REGGACAGGTGGGCCCCACC+3511442435114440-741-725
 OsREG501GACAGGTG          PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG         PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647      TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641       GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631        GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612         GCCCCACC PPDB Motif  PLACE Motif 
REGCCCACCTGTC+3511445135114460-714-705
 OsREG514CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501  CACCTGTC PPDB Motif  PLACE Motif 
REGCACACACC+3511447635114483-689-682
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGCTTGGGCCCCACCTGTCAGT+3511450035114519-665-646
 OsREG581CTTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG639 TTGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC         PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC        PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT     PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC    PPDB Motif  PLACE Motif 
 OsREG551           CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453            CTGTCAGT PPDB Motif  PLACE MotifTGAC 
REGGGACGCGT+3511455335114560-612-605
 OsREG442GGACGCGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.