version
PlantPromoterDB promoter information of AK100026

Summary of Gene (AK100026)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0534000        NCBI 
Gene model AK100026  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 9: 21818889-21817690)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK100026                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100026

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-21818021-132

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCT-2181798121817989-92-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGTGGCCACGTGGG-2181815021818165-261-276
 OsREG585GACGTGGC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507      GCCACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508        CACGTGGG PPDB MotifACGT  PLACE Motif 
REGCTGGCCCAGC-2181820821818217-319-328
 OsREG577CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCT-2181823521818242-346-353
 OsREG459CTTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCCAGGCCCAAAA-2181829021818308-401-419
 OsREG596TATTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG524       CCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513        CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471         AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625          GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592           GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.