version
PlantPromoterDB promoter information of AK100033

Summary of Gene (AK100033)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0370000        NCBI 
Gene model AK100033  
Description Similar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99).  
#
#

Overview

Focused view (chromosome 3: 15076484-15077683)

Genome position     
from initiation codon
016-020-E09         
J013088A15          
J013149J07          
J013160H02          
J023052K01          
J033075E17          
J033132O03          
J065138A12          
J065205P12          
J090050C03          
J100036J24          
J100039O18          
J100039P14          
TSS from cDNA
TSS information
AK100033                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100033

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+15077311-173

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCCCC+1507729515077304-189-180
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGTC+1507706815077076-416-408
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCACCTGTCAG+1507708615077097-398-387
 OsREG514CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501  CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551    CCTGTCAG PPDB Motif  PLACE MotifTGAC 
REGCCTGGGCCCCACCAC+1507722215077236-262-248
 OsREG550CCTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG527       CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGGCCCACC+1507725415077266-230-218
 OsREG612GGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.