version
PlantPromoterDB promoter information of AK100043

Summary of Gene (AK100043)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0721800        NCBI 
Gene model AK100043  
Description Similar to Phosphatidylinositol transfer-like protein IV.  
#
#

Overview

Focused view (chromosome 2: 30844019-30842820)

Genome position     
from initiation codon
J013152L11          
J013162C02          
J033108C10          
J033128L09          
J065017F07          
J065040G22          
J065045O06          
J065050B06          
J065055D16          
J065102C05          
J065110L14          
J065141B18          
J065188M22          
J090093A20          
J090093G24          
J100037J11          
TSS from cDNA
TSS information
AK100043                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100043

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-30843672-653

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCC-3084375630843763-737-744
 OsREG419AAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCACTGACGCGTGGGCCCCACA-3084376630843787-747-768
 OsREG522CCACTGAC               PPDB Motif  PLACE MotifTGAC 
 OsREG443      ACGCGTGG         PPDB Motif  PLACE Motif 
 OsREG530       CGCGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG602        GCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571         CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640          GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647           TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641            GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631             GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611              GCCCCACA PPDB Motif  PLACE Motif 
REGGCGGGCCCCACGTGTCC-3084390830843924-889-905
 OsREG619GCGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG567 CGGGCCCC         PPDB MotifACGGGC  PLACE Motif 
 OsREG641  GGGCCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC       PPDB Motif  PLACE Motif 
 OsREG572    GCCCCACG      PPDB Motif  PLACE Motif 
 OsREG450     CCCCACGT     PPDB MotifACGT  PLACE Motif 
 OsREG508      CCCACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG434       CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509        CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451         ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.