version
PlantPromoterDB promoter information of AK100057

Summary of Gene (AK100057)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0408200        NCBI 
Gene model AK100057  
Description SBP domain containing protein.  
#
#

Overview

Focused view (chromosome 5: 19929214-19930413)

Genome position     
from initiation codon
J013158B16          
J033024M19          
J090034I01          
J100025L13          
J100082O06          
TSS from cDNA
TSS information
AK100057                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100057

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+19929980-234

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCATCCCCC+1992968719929694-527-520
 OsREG516CATCCCCC PPDB Motif  PLACE Motif 
REGCCGTCCGA+1992970119929708-513-506
 OsREG545CCGTCCGA PPDB Motif  PLACE Motif 
REGCATCCCCC+1992972219929729-492-485
 OsREG516CATCCCCC PPDB Motif  PLACE Motif 
REGGACGGCCC+1992974919929756-465-458
 OsREG584GACGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCGGGCCCCACGCGCGACGC+1992978119929800-433-414
 OsREG619GCGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG567 CGGGCCCC            PPDB MotifACGGGC  PLACE Motif 
 OsREG641  GGGCCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC          PPDB Motif  PLACE Motif 
 OsREG572    GCCCCACG         PPDB Motif  PLACE Motif 
 OsREG530      CCCACGCG       PPDB MotifGCCCA  PLACE Motif 
 OsREG557          CGCGCGAC   PPDB MotifACGCGC  PLACE Motif 
 OsREG556            CGCGACGC PPDB Motif  PLACE MotifCGACG 
REGCACTGACA+1992980919929816-405-398
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGCCCCCACG+1992984719929854-367-360
 OsREG536CCCCCACG PPDB Motif  PLACE Motif 
REGCCACGGCCACCAAC+1992989419929907-320-307
 OsREG521CCACGGCC       PPDB Motif  PLACE Motif 
 OsREG520      CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGCGGGCCCACCCG+1992990919929921-305-293
 OsREG619GCGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600    GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528     CCCACCCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.