version
PlantPromoterDB promoter information of AK100114

Summary of Gene (AK100114)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0257900        NCBI 
Gene model AK100114  
Description Similar to Lectin-like receptor kinase 7;2.  
#
#

Overview

Focused view (chromosome 3: 8387256-8388455)

Genome position     
from initiation codon
                    
009-150-G06         
009-181-H05         
AK063892            
AK103486            
J023006K11          
J075005E15          
J075007K24          
J075034G06          
J075051I19          
J075076A08          
J075096H04          
J075115I09          
J075132K23          
J075147C17          
J090059O20          
Os03g0257850        
TSS from cDNA
TSS information
AK100114                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK100114

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+8388141-115
TSS clone peakGclone+8388164-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCC+83881478388154-109-102
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTTGGGCCAA+83880238388033-233-223
 OsREG594TGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCTTTTTGGGCCGA+83880378388057-219-199
 OsREG433AATTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG592          TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625           TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG563            TTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658             TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATTT+83880668388074-190-182
 OsREG432AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422 GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGCCTCGCCCACCAAC+83880888388101-168-155
 OsREG549CCTCGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520      CCACCAAC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.